Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01552
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01552
Clone name ej00702
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MMRN1
cDNA sequence DNA sequence (4976 bp)
Predicted protein sequence (1236 aa)
Flexi ORF Clone FXC01552
Description Multimerin-1 precursor (Endothelial cell multimerin 1) (EMILIN-4) (Elastin microfibril interface located protein 4) (Elastin microfibril interfacer 4).
Features of the cloned cDNA sequence

Length: 4976 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1190 bp
Genome contig ID gi89161207f_90935047
PolyA signal sequence
(AATAAA,-15)		 
+----*----+----*----+----*----+----
AACAGATTTTCATAAGTAATAATAAAAATAATAAT
Flanking genome sequence
(159737 - 159786)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAGTTTTGGTATGGTAAGCCTTTTTTATGAATTGATTTGTTTAATG

Features of the protein sequence

Length: 1236 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q13201 0 100.0 Multimerin-1; E...
 Homo sapiens
AAH63848 0 99.9 Multimerin 1 [H...
 Homo sapiens
AAC52065 0 99.8 prepromultimeri...
 Homo sapiens
XP_517342 0 98.2 hypothetical pr...
 Pan troglodytes
XP_001101702 0 93.8 similar to mult...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001073 1118 1144 PR00007 Complement C1q protein
IPR001073 1145 1164 PR00007 Complement C1q protein
IPR001073 1193 1214 PR00007 Complement C1q protein
IPR001073 1224 1234 PR00007 Complement C1q protein
HMMPfam IPR011489 215 287 PF07546 EMI
IPR006209 1053 1084 PF00008 EGF-like
IPR001073 1110 1233 PF00386 Complement C1q protein
HMMSmart IPR006210 1052 1085 SM00181 EGF
IPR001881 1053 1085 SM00179 EGF-like calcium-binding
IPR001073 1102 1236 SM00110 Complement C1q protein
ProfileScan IPR011489 215 290 PS51041 EMI
IPR000742 1049 1085 PS50026 EGF-like
IPR001073 1104 1236 PS50871 Complement C1q protein
ScanRegExp IPR000152 1064 1075 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1073 1084 PS00022 EGF-like region
IPR013032 1073 1084 PS01186 EGF-like region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp