Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01563
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01563
Clone name ek00291
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MMP2
cDNA sequence DNA sequence (2953 bp)
Predicted protein sequence (708 aa)
Flexi ORF Clone FXC01563
Description 72 kDa type IV collagenase precursor (EC 3.4.24.24) (72 kDa gelatinase) (Matrix metalloproteinase-2) (MMP-2) (Gelatinase A) (TBE- 1).
Features of the cloned cDNA sequence

Length: 2953 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 797 bp
Genome contig ID gi51511732f_53970720
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TCAACAAGTATGAATAAAGACACCTACTGAGTGGC
Flanking genome sequence
(126934 - 126983)
----+----*----+----*----+----*----+----*----+----*
CGTGTTTGCCATCTGTTTTAGCAGAGCCTAGACAAGGGCCACAGACCCAG

Features of the protein sequence

Length: 708 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P08253 0 100.0 72 kDa type IV ...
Homo sapiens
AAX43100 0 100.0 matrix metallop...
synthetic construct
XP_001087939 0 99.6 similar to matr...
Macaca mulatta
BAG35588 0 99.6 unnamed protein...
Homo sapiens
XP_001167520 0 98.1 matrix metallop...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000562 274 323 PD000995 Type II fibronectin
IPR000562 371 440 PD000995 Type II fibronectin
FPrintScan IPR001818 145 158 PR00138 Peptidase M10A and M12B
IPR001818 192 207 PR00138 Peptidase M10A and M12B
IPR001818 215 243 PR00138 Peptidase M10A and M12B
IPR000562 394 403 PR00013 Type II fibronectin
IPR000562 405 417 PR00013 Type II fibronectin
IPR000562 422 437 PR00013 Type II fibronectin
IPR001818 448 473 PR00138 Peptidase M10A and M12B
IPR001818 481 494 PR00138 Peptidase M10A and M12B
HMMPfam IPR002477 118 149 PF01471 Peptidoglycan binding-like
IPR001818 166 494 PF00413 Peptidase M10A and M12B
IPR000562 281 322 PF00040 Type II fibronectin
IPR000562 339 380 PF00040 Type II fibronectin
IPR000562 397 438 PF00040 Type II fibronectin
IPR000585 523 566 PF00045 Hemopexin
IPR000585 568 611 PF00045 Hemopexin
IPR000585 616 663 PF00045 Hemopexin
IPR000585 665 708 PF00045 Hemopexin
HMMSmart IPR006026 163 495 SM00235 Peptidase
IPR000562 274 322 SM00059 Type II fibronectin
IPR000562 332 380 SM00059 Type II fibronectin
IPR000562 390 438 SM00059 Type II fibronectin
IPR000585 523 566 SM00120 Hemopexin
IPR000585 568 611 SM00120 Hemopexin
IPR000585 616 663 SM00120 Hemopexin
IPR000585 665 708 SM00120 Hemopexin
ProfileScan IPR000562 276 324 PS51092 Type II fibronectin
IPR000562 334 382 PS51092 Type II fibronectin
IPR000562 392 440 PS51092 Type II fibronectin
ScanRegExp IPR001818 148 155 PS00546 Peptidase M10A and M12B
IPR000562 281 322 PS00023 Type II fibronectin
IPR000562 339 380 PS00023 Type II fibronectin
IPR000562 397 438 PS00023 Type II fibronectin
IPR006025 448 457 PS00142 Peptidase M
IPR000585 654 669 PS00024 Hemopexin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp