ORK01581

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01581

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01581
Clone name	aj00591
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TEF
cDNA sequence	DNA sequence (4243 bp) Predicted protein sequence (292 aa)
HaloTag ORF Clone	FHC01581
Flexi ORF Clone	FXC01581
Description	Thyrotroph embryonic factor.

Features of the cloned cDNA sequence

Description

Length: 4243 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3364 bp
Genome contig ID	gi89161203f_39993426
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TCCTTTTCAGACAAAATTAAATATTTTGAAATGAG
Flanking genome sequence (131850 - 131899)	----+--------+--------+--------+--------+----* AATGTTGGGATTGTCTTTTCTGTCCTTCTCCCCACCCCCAACCCTGAGTT

Features of the protein sequence

Description

Length: 292 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_849323	1.1e-103	97.5	similar to thyr...	Canis lupus fam...
CAH91521	2.5e-102	100.0	hypothetical pr...	Pongo abelii
AAS45600	2.6e-102	96.1	thyrotroph embr...	Mus musculus
XP_001502491	8.8e-101	98.1	similar to thyr...	Equus caballus
AAH17689	9.9e-100	97.4	Thyrotroph embr...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011700	221	274	PF07716	Basic leucine zipper
HMMSmart	IPR004827	220	284	SM00338	Basic-leucine zipper (bZIP) transcription factor
ProfileScan	IPR004827	222	285	PS50217	Basic-leucine zipper (bZIP) transcription factor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp