Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01582
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01582
Clone name ha01636
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of th ...
Symbol CCND3
cDNA sequence DNA sequence (1937 bp)
Predicted protein sequence (316 aa)
Flexi ORF Clone FXC01582
Description G1/S-specific cyclin-D3.
Features of the cloned cDNA sequence

Length: 1937 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 984 bp
Genome contig ID gi89161210r_41910672
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CCATCATCCTACTGTAATAAAGATGATTGTGAAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAACTGGCTTTGGCTTCTTGGATTGGTGTGTGGGTAAGTCTATTTCTGC

Features of the protein sequence

Length: 316 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAM51826 3.1e-120 100.0 cyclin D3 [Homo...
Homo sapiens
P30281 5.6e-120 99.6 G1/S-specific c...
Homo sapiens
AAX29808 5.6e-120 99.6 cyclin D3 [synt...
synthetic construct
ABW05542 8.9e-120 99.6 cyclin D3 (pred...
Papio anubis
AAX36623 4e-119 99.6 cyclin D3 [synt...
synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006671 50 177 PF00134 Cyclin
IPR004367 179 308 PF02984 Cyclin
HMMSmart IPR006670 86 170 SM00385 Cyclin
ScanRegExp IPR006671 81 112 PS00292 Cyclin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp