ORK01585

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01585

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01585
Clone name	ha00462
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of th ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	CCND2
cDNA sequence	DNA sequence (6478 bp) Predicted protein sequence (378 aa)
HaloTag ORF Clone	FHC01585
Flexi ORF Clone	FXC01585
Description	G1/S-specific cyclin-D2.

Features of the cloned cDNA sequence

Description

Length: 6478 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	5339 bp
Genome contig ID	gi89161190f_4153199
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GTTATGCTATTTGGACAATAAACTCACCTTGACCT
Flanking genome sequence (131580 - 131629)	----+--------+--------+--------+--------+----* AAATTATCTGGCCGTTTTTGACTTATTTATAAACCAGCAGTCCTCAGAAT

Features of the protein sequence

Description

Length: 378 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P30279	1.7e-100	100.0	G1/S-specific c...	Homo sapiens
AAV38649	1.7e-100	100.0	cyclin D2 [synt...	synthetic construct
BAD97297	2e-100	99.6	cyclin D2 varia...	Homo sapiens
AAX42741	3.8e-100	99.6	cyclin D2 [synt...	synthetic construct
AAX41165	4.9e-100	99.6	cyclin D2 [synt...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006671	114	241	PF00134	Cyclin
HMMPfam	IPR004367	243	370	PF02984	Cyclin
HMMSmart	IPR006670	150	234	SM00385	Cyclin
ScanRegExp	IPR006671	145	176	PS00292	Cyclin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp