ORK01644

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01644

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01644
Clone name	ff00542
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	GAS2L2
cDNA sequence	DNA sequence (4111 bp) Predicted protein sequence (972 aa)
HaloTag ORF Clone	FHC01644
Flexi ORF Clone	FXC01644
Description	GAS2-like protein 2 (Growth arrest-specific 2-like 2) (GAS2-related protein on chromosome 17) (GAR17 protein).

Features of the cloned cDNA sequence

Description

Length: 4111 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	338 bp
Genome contig ID	gi51511734r_30995648
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- ACTCCCATAAGTTATTAAATGCATGTGATTCTGCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTTGAGCCCCCAGCTTCTTTTTTCAAATTTCAGAAACAGAGTCTTGCTCT

Features of the protein sequence

Description

Length: 972 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8NHY3	0	100.0	GAS2-like prote...	Homo sapiens
XP_001174066	0	98.2	growth arrest-s...	Pan troglodytes
XP_001114413	0	90.7	similar to grow...	Macaca mulatta
XP_585382	1.4e-208	72.8	similar to grow...	Bos taurus
XP_001917950	2.9e-168	71.5	growth arrest-s...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001715	125	251	PF00307	Calponin-like actin-binding
HMMPfam	IPR003108	296	368	PF02187	Growth-arrest-specific protein 2
HMMSmart	IPR001715	126	246	SM00033	Calponin-like actin-binding
HMMSmart	IPR003108	296	368	SM00243	Growth-arrest-specific protein 2
ProfileScan	IPR001715	124	250	PS50021	Calponin-like actin-binding

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp