ORK01685

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01685

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01685
Clone name	af05715
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PCDH19
cDNA sequence	DNA sequence (8557 bp) Predicted protein sequence (1309 aa)
HaloTag ORF Clone	FHC01685
Flexi ORF Clone	FXC01685
Description	Protocadherin-19 precursor.

Features of the cloned cDNA sequence

Description

Length: 8557 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4625 bp
Genome contig ID	gi89161218r_99333306
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- AATTTAATGCATTTTAGTATTAAAGGCTATTATGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAGTATTGAGTGTTTGGTGGAATGTGTTTCAGAGAGTGTTTGTAGGC

Features of the protein sequence

Description

Length: 1309 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_602429	94.1	similar to prot...	Bos taurus
XP_001914715	97.8	protocadherin 1...	Equus caballus
BAG10449	100.0	protocadherin-1...	synthetic construct
NP_065817	99.9	protocadherin-1...	Homo sapiens
XP_549133	97.3	similar to Prot...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	278	297	PR00205	Cadherin
	IPR002126	446	475	PR00205	Cadherin
	IPR002126	519	531	PR00205	Cadherin
	IPR002126	533	552	PR00205	Cadherin
	IPR002126	659	672	PR00205	Cadherin
	IPR002126	719	745	PR00205	Cadherin
	IPR002126	753	770	PR00205	Cadherin
HMMPfam	IPR013164	231	317	PF08266	Cadherin
	IPR002126	342	437	PF00028	Cadherin
	IPR002126	451	545	PF00028	Cadherin
	IPR002126	562	652	PF00028	Cadherin
	IPR002126	666	762	PF00028	Cadherin
	IPR002126	781	871	PF00028	Cadherin
HMMSmart	IPR002126	258	335	SM00112	Cadherin
	IPR002126	359	444	SM00112	Cadherin
	IPR002126	468	552	SM00112	Cadherin
	IPR002126	579	659	SM00112	Cadherin
	IPR002126	683	769	SM00112	Cadherin
	IPR002126	798	878	SM00112	Cadherin
ProfileScan	IPR002126	236	337	PS50268	Cadherin
	IPR002126	338	446	PS50268	Cadherin
	IPR002126	447	554	PS50268	Cadherin
	IPR002126	558	661	PS50268	Cadherin
	IPR002126	662	771	PS50268	Cadherin
	IPR002126	777	880	PS50268	Cadherin
ScanRegExp	IPR002126	325	335	PS00232	Cadherin
	IPR002126	434	444	PS00232	Cadherin
	IPR002126	542	552	PS00232	Cadherin
	IPR002126	649	659	PS00232	Cadherin
	IPR002126	759	769	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	211	SLLLPVLLLLAILWTQAAALINL	233	PRIMARY	23
	2	858	TSLSASALVLIYLSPALDAQESM	880	SECONDARY	23
	3	885	LSLIFIIALGSIAGILFVTMIFV	907	PRIMARY	23