ORK01702

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01702

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01702
Clone name	bm03010
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	RBM42
cDNA sequence	DNA sequence (1658 bp) Predicted protein sequence (493 aa)
HaloTag ORF Clone	FHC01702
Flexi ORF Clone	FXC01702
Description	RNA binding motif protein 42

Features of the cloned cDNA sequence

Description

Length: 1658 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	130 bp
Genome contig ID	gi42406306f_40711811
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CCAAAACCAGTTTCAATAAATTTACGTTCATTTCC
Flanking genome sequence (108617 - 108666)	----+--------+--------+--------+--------+----* ACCCCTGGCTGGGCATGGAAGCACGCTGTGGGGAGCAGGGCTTGGCTTCC

Features of the protein sequence

Description

Length: 493 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9BTD8	8.6e-139	100.0	RNA-binding pro...	Homo sapiens
XP_001096199	2e-138	99.7	similar to Temp...	Macaca mulatta
XP_524226	5.2e-136	98.5	similar to MGC1...	Pan troglodytes
XP_001096086	1.2e-135	98.3	similar to Temp...	Macaca mulatta
XP_001492287	4.5e-135	98.1	similar to RNA ...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	396	467	PF00076	RNA recognition motif
HMMSmart	IPR000504	395	468	SM00360	RNA recognition motif
ProfileScan	IPR000504	394	472	PS50102	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp