Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01705
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01705
Clone name fj17066
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CBX8
cDNA sequence DNA sequence (3745 bp)
Predicted protein sequence (413 aa)
Flexi ORF Clone FXC01705
Description Chromobox protein homolog 8 (Polycomb 3 homolog) (Pc3) (hPc3) (Rectachrome 1).
Features of the cloned cDNA sequence

Length: 3745 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2502 bp
Genome contig ID gi51511734r_75280527
PolyA signal sequence
(AATATA,-20)
+----*----+----*----+----*----+----
CTTTTTACGTGTTTAAATATATACTTTGTAAATAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGACATGTCTTGGTTTTATTCTTCTTTTTCCTTCCCTGAGCAAAGGGAAG

Features of the protein sequence

Length: 413 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAF76328 1.3e-130 100.0 rectachrome 1 [...
Homo sapiens
Q9HC52 4.1e-130 99.7 Chromobox prote...
Homo sapiens
XP_001490422 1.1e-121 93.8 similar to chro...
Equus caballus
XP_523736 1.1e-69 66.0 chromobox homol...
Pan troglodytes
XP_850749 3.6e-69 91.0 similar to Chro...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000953 35 84 PF00385 Chromo
HMMSmart IPR000953 34 86 SM00298 Chromo
ProfileScan IPR000953 35 93 PS50013 Chromo
ScanRegExp IPR000953 52 72 PS00598 Chromo
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp