ORK01721

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01721

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01721
Clone name	fk02333
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	YME1L1
cDNA sequence	DNA sequence (3498 bp) Predicted protein sequence (754 aa)
HaloTag ORF Clone	FHC01721
Flexi ORF Clone	FXC01721
Description	ATP-dependent metalloprotease YME1L1 (EC 3.4.24.-) (YME1-like protein 1) (ATP-dependent metalloprotease FtsH1) (Meg-4) (Presenilin- associated metalloprotease) (PAMP).

Features of the cloned cDNA sequence

Description

Length: 3498 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1232 bp
Genome contig ID	gi89161187r_27339680
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- AGAAGCAGTATTTTGTTAAATAAATACATAACCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCTGAATAATGTCCCTCATTTTGACTATAACTGTGCTTGGTTTCAAAA

Features of the protein sequence

Description

Length: 754 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAB51858	100.0	ATP-dependent m...	Homo sapiens
BAF83981	99.8	unnamed protein...	Homo sapiens
CAH92425	99.7	hypothetical pr...	Pongo abelii
BAE01831	99.4	unnamed protein...	Macaca fascicularis
XP_535172	94.2	similar to YME1...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003959	355	540	PF00004	AAA ATPase
HMMPfam	IPR000642	547	745	PF01434	Peptidase M41
HMMSmart	IPR003593	352	489	SM00382	AAA+ ATPase
HMMTigr	IPR005936	269	747	TIGR01241	Peptidase M41
ScanRegExp	IPR003960	457	475	PS00674	AAA ATPase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	275	RLILFVLLLFGIYGLLKNPFLSV	297	PRIMARY	23