ORK01724

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01724

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01724
Clone name	fh04242
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PCDHB12
cDNA sequence	DNA sequence (4363 bp) Predicted protein sequence (809 aa)
Flexi ORF Clone	FXC01724
Description	protocadherin beta 12

Features of the cloned cDNA sequence

Description

Length: 4363 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	723 bp
Genome contig ID	gi51511721f_140461102
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ATCTTTATTTAGAAATAAACTTTATCTATGATTTC
Flanking genome sequence (110674 - 110723)	----+--------+--------+--------+--------+----* ATTTTCTTATAAACCAGTAATCTTGCTTTTCTGGGTAAATTTTCAGCTAT

Features of the protein sequence

Description

Length: 809 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y5F1	100.0	Protocadherin b...	Homo sapiens
Q5DRD7	97.7	Protocadherin b...	Pan troglodytes
XP_001087513	93.9	protocadherin b...	Macaca mulatta
XP_001145920	90.1	similar to Prot...	Pan troglodytes
Q5DRD8	89.4	Protocadherin b...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	87	106	PR00205	Cadherin
	IPR002126	256	285	PR00205	Cadherin
	IPR002126	328	340	PR00205	Cadherin
	IPR002126	340	359	PR00205	Cadherin
	IPR002126	463	476	PR00205	Cadherin
	IPR002126	523	549	PR00205	Cadherin
	IPR002126	557	574	PR00205	Cadherin
HMMPfam	IPR013164	43	126	PF08266	Cadherin
	IPR002126	152	247	PF00028	Cadherin
	IPR002126	261	352	PF00028	Cadherin
	IPR002126	366	456	PF00028	Cadherin
	IPR002126	470	566	PF00028	Cadherin
	IPR002126	594	677	PF00028	Cadherin
HMMSmart	IPR002126	68	145	SM00112	Cadherin
	IPR002126	169	254	SM00112	Cadherin
	IPR002126	278	359	SM00112	Cadherin
	IPR002126	382	463	SM00112	Cadherin
	IPR002126	487	573	SM00112	Cadherin
	IPR002126	603	684	SM00112	Cadherin
ProfileScan	IPR002126	89	147	PS50268	Cadherin
	IPR002126	148	256	PS50268	Cadherin
	IPR002126	257	361	PS50268	Cadherin
	IPR002126	362	465	PS50268	Cadherin
	IPR002126	466	575	PS50268	Cadherin
	IPR002126	594	685	PS50268	Cadherin
ScanRegExp	IPR002126	135	145	PS00232	Cadherin
	IPR002126	244	254	PS00232	Cadherin
	IPR002126	349	359	PS00232	Cadherin
	IPR002126	453	463	PS00232	Cadherin
	IPR002126	563	573	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	23	LQIRQVLLFFVLLGMSQAGSETG	45	SECONDARY	23
SOSUI2	2	703	YLVVALASVSSLFLFSVLLFVAV	725	PRIMARY	23