ORK01758

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01758

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01758
Clone name	fj18320
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SKP2
cDNA sequence	DNA sequence (3413 bp) Predicted protein sequence (431 aa)
HaloTag ORF Clone	FHC01758
Flexi ORF Clone	FXC01758
Description	S-phase kinase-associated protein 2 (F-box protein Skp2) (Cyclin A/CDK2-associated protein p45) (p45skp2) (F-box/LRR-repeat protein 1).

Features of the cloned cDNA sequence

Description

Length: 3413 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1995 bp
Genome contig ID	gi51511721f_36087979
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TAGACTTGTTTTAAAACAATAAAACACATTTTTAT
Flanking genome sequence (131906 - 131955)	----+--------+--------+--------+--------+----* AAAAATGAGTGCTTAAACTAAGTTGTATTCCTTTTTTCTTTCTCTTTTTT

Features of the protein sequence

Description

Length: 431 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q13309	6.9e-180	100.0	S-phase kinase-...	Homo sapiens
AAX41540	2.7e-179	99.7	S-phase kinase-...	synthetic construct
AAC50242	6.7e-177	96.9	cyclin A/CDK2-a...	Homo sapiens
XP_001499872	5.8e-169	92.9	S-phase kinase-...	Equus caballus
XP_546346	1.2e-168	92.1	similar to S-ph...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001810	102	149	PF00646	Cyclin-like F-box
HMMPfam	IPR013101	238	263	PF07723	Leucine-rich repeat 2
HMMSmart	IPR001810	107	147	SM00256	Cyclin-like F-box
	IPR006553	212	236	SM00367	Leucine-rich repeat
	IPR006553	237	261	SM00367	Leucine-rich repeat
	IPR006553	262	291	SM00367	Leucine-rich repeat
	IPR006553	316	341	SM00367	Leucine-rich repeat
	IPR006553	342	366	SM00367	Leucine-rich repeat
ProfileScan	IPR001810	101	147	PS50181	Cyclin-like F-box

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp