ORK01776

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01776

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01776
Clone name	fk10490
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	POU3F2
cDNA sequence	DNA sequence (3616 bp) Predicted protein sequence (319 aa)
HaloTag ORF Clone	FHC01776
Flexi ORF Clone	FXC01776
Description	POU domain, class 3, transcription factor 2 (Nervous system-specific octamer-binding transcription factor N-Oct-3) (Brain-specific homeobox/POU domain protein 2) (Brain-2) (Protein Brn-2).

Features of the cloned cDNA sequence

Description

Length: 3616 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2585 bp
Genome contig ID	gi89161210f_99289292
PolyA signal sequence (CATAAA,-21)	+--------+--------+----*----+---- TATTTTATTATCTACATAAAACAGAAATGCACAAT
Flanking genome sequence (104096 - 104145)	----+--------+--------+--------+--------+----* ACCTTCATAGTTTGTTCTAATTATTGAAATATCTTTATTTTATTTTTAAA

Features of the protein sequence

Description

Length: 319 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG11394	5.1e-98	100.0	POU domain, cla...	synthetic construct
XP_001501398	4.3e-92	95.5	similar to POU ...	Equus caballus
AAI12697	9.3e-76	60.2	POU class 3 hom...	Bos taurus
CAA77990	1.6e-75	59.5	N-Oct 3 octamer...	Homo sapiens
AAB59611	1.6e-75	59.8	POU-domain tran...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000327	142	212	PD000583	POU-specific
BlastProDom	IPR001356	230	286	PD000010	Homeobox
FPrintScan	IPR013847	157	174	PR00028	POU
	IPR013847	180	193	PR00028	POU
	IPR013847	196	211	PR00028	POU
	IPR013847	229	249	PR00028	POU
	IPR013847	264	279	PR00028	POU
	IPR001356	267	277	PR00024	Homeobox
	IPR001356	277	286	PR00024	Homeobox
HMMPfam	IPR000327	138	212	PF00157	POU-specific
HMMPfam	IPR001356	231	287	PF00046	Homeobox
HMMSmart	IPR000327	138	212	SM00352	POU-specific
HMMSmart	IPR001356	230	292	SM00389	Homeobox
ProfileScan	IPR000327	138	212	PS51179	POU-specific
ProfileScan	IPR001356	228	288	PS50071	Homeobox
ScanRegExp	IPR000327	156	168	PS00035	POU-specific
	IPR000327	180	193	PS00465	POU-specific
	IPR001356	263	286	PS00027	Homeobox

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp