ORK01836

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01836

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01836
Clone name	ff04527
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CELF3
cDNA sequence	DNA sequence (4125 bp) Predicted protein sequence (511 aa)
HaloTag ORF Clone	FHC01836
Flexi ORF Clone	FXC01836
Description	trinucleotide repeat containing 4

Features of the cloned cDNA sequence

Description

Length: 4125 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1957 bp
Genome contig ID	gi89161185r_149841505
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CTTTTCTGTCTAAATAAAGAAAAAAGTTTAAAAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCAAATAAGAGTCTTGGAAGGTTGAGGGTAGGGGATTGTTCCCTACCCA

Features of the protein sequence

Description

Length: 511 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL38738	4.5e-134	94.5	trinucleotide r...	Mus musculus
Q5SZQ8	1.3e-130	100.0	CUG-BP- and ETR...	Homo sapiens
AAN73884	2.2e-130	99.7	CUG-BP and ETR-...	Homo sapiens
EDL38740	8.1e-130	99.5	trinucleotide r...	Mus musculus
ABY40803	1.2e-129	98.7	trinucleotide r...	Papio anubis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	55	129	PF00076	RNA recognition motif
	IPR000504	143	214	PF00076	RNA recognition motif
	IPR000504	428	499	PF00076	RNA recognition motif
HMMSmart	IPR000504	54	130	SM00360	RNA recognition motif
	IPR000504	142	217	SM00360	RNA recognition motif
	IPR000504	427	500	SM00360	RNA recognition motif
ProfileScan	IPR000504	53	134	PS50102	RNA recognition motif
	IPR000504	141	221	PS50102	RNA recognition motif
	IPR000504	426	504	PS50102	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp