ORK01837

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01837

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01837
Clone name	hj02541
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	FARP1
cDNA sequence	DNA sequence (4794 bp) Predicted protein sequence (1049 aa)
HaloTag ORF Clone	FHC01837
Flexi ORF Clone	FXC01837
Description	FERM, RhoGEF and pleckstrin domain-containing protein 1 (Chondrocyte- derived ezrin-like protein).

Features of the cloned cDNA sequence

Description

Length: 4794 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1574 bp
Genome contig ID	gi51511729f_97493689
PolyA signal sequence (AATAAA,-33)	+--------+--------+----*----+---- GAAATAAATGCCTCTAGAATGAGGTATGTGATGCT
Flanking genome sequence (412508 - 412557)	----+--------+--------+--------+--------+----* AAGTTTGAGAAATCAAAAAGTTTGTGTTCAGGCAAAAGATGGGTGACTTT

Features of the protein sequence

Description

Length: 1049 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11032	100.0	FERM, RhoGEF an...	synthetic construct
Q9Y4F1	99.9	FERM, RhoGEF an...	Homo sapiens
XP_001142564	99.4	FERM, RhoGEF, a...	Pan troglodytes
XP_001142428	99.0	FERM, RhoGEF, a...	Pan troglodytes
Q5RAB8	97.9	FERM, RhoGEF an...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000798	57	76	PR00661	Ezrin/radixin/moesin ERM
	IPR000299	77	89	PR00935	Band 4.1
	IPR000798	108	127	PR00661	Ezrin/radixin/moesin ERM
	IPR000299	142	155	PR00935	Band 4.1
	IPR000798	151	172	PR00661	Ezrin/radixin/moesin ERM
	IPR000299	155	175	PR00935	Band 4.1
	IPR000299	214	230	PR00935	Band 4.1
	IPR000798	237	257	PR00661	Ezrin/radixin/moesin ERM
HMMPfam	IPR000299	46	234	PF00373	Band 4.1
	IPR014847	330	378	PF08736	FERM adjacent (FA)
	IPR000219	548	733	PF00621	DH
	IPR001849	764	860	PF00169	Pleckstrin-like
	IPR001849	937	1033	PF00169	Pleckstrin-like
HMMSmart	IPR000299	40	234	SM00295	Band 4.1
	IPR000219	548	733	SM00325	DH
	IPR001849	764	862	SM00233	Pleckstrin-like
	IPR001849	937	1035	SM00233	Pleckstrin-like
ProfileScan	IPR000299	44	324	PS50057	Band 4.1
	IPR000219	544	734	PS50010	DH
	IPR001849	763	860	PS50003	Pleckstrin-like
	IPR001849	936	1033	PS50003	Pleckstrin-like
ScanRegExp	IPR000299	98	127	PS00660	Band 4.1

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp