ORK01838

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01838

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01838
Clone name	fj13059
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SEMA6B
cDNA sequence	DNA sequence (3711 bp) Predicted protein sequence (901 aa)
HaloTag ORF Clone	FHC01838
Flexi ORF Clone	FXC01838
Description	Semaphorin-6B precursor (Semaphorin Z) (Sema Z).

Features of the cloned cDNA sequence

Description

Length: 3711 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1003 bp
Genome contig ID	gi42406306r_4393610
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- CCCAGCCCCCTCCCCATCAATAAAACTCTGTTTAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCACCGGCCCCCATGACTCTGGCTCTGCTCTGCCTCCTGGGGGTGGCA

Features of the protein sequence

Description

Length: 901 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9H3T3	100.0	Semaphorin-6B; ...	Homo sapiens
BAB20669	99.8	semaphorin Z [H...	Homo sapiens
O54951	89.2	Semaphorin-6B; ...	Mus musculus
EDL83655	88.2	sema domain, tr...	Rattus norvegicus
BAE38558	89.1	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001627	78	502	PF01403	Semaphorin/CD100 antigen
HMMPfam	IPR002165	538	588	PF01437	Plexin
HMMSmart	IPR001627	78	509	SM00630	Semaphorin/CD100 antigen
ProfileScan	IPR001627	44	536	PS51004	Semaphorin/CD100 antigen

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp