ORK01850

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01850

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01850
Clone name	hj02958
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NR1D2
cDNA sequence	DNA sequence (5150 bp) Predicted protein sequence (619 aa)
HaloTag ORF Clone	FHC01850
Flexi ORF Clone	FXC01850
Description	Orphan nuclear receptor NR1D2 (Rev-erb-beta) (EAR-1R) (Orphan nuclear hormone receptor BD73).

Features of the cloned cDNA sequence

Description

Length: 5150 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3196 bp
Genome contig ID	gi89161205f_23861863
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TATGTGGGGGGAGGGGATAATAAATATTTCTAACC
Flanking genome sequence (135249 - 135298)	----+--------+--------+--------+--------+----* AACTGTGGTGTTTGGTGTCTAATCTACCTTGCCTTTTTTGTAAAACTAAT

Features of the protein sequence

Description

Length: 619 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14995	100.0	Nuclear recepto...	Homo sapiens
AAX36866	100.0	nuclear recepto...	synthetic construct
CAG33715	99.8	NR1D2 [Homo sap...	Homo sapiens
XP_516330	99.4	nuclear recepto...	Pan troglodytes
AAH45613	99.4	Nuclear recepto...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001628	142	210	PD000035	Zinc finger
FPrintScan	IPR001628	143	159	PR00047	Zinc finger
	IPR000324	143	159	PR00350	Vitamin D receptor
	IPR001628	159	174	PR00047	Zinc finger
	IPR000324	160	179	PR00350	Vitamin D receptor
	IPR001628	193	201	PR00047	Zinc finger
	IPR001628	201	209	PR00047	Zinc finger
	IPR001723	205	215	PR00398	Steroid hormone receptor
	IPR001723	448	469	PR00398	Steroid hormone receptor
	IPR001723	469	485	PR00398	Steroid hormone receptor
	IPR001723	536	551	PR00398	Steroid hormone receptor
	IPR001723	593	610	PR00398	Steroid hormone receptor
HMMPfam	IPR001628	141	217	PF00105	Zinc finger
HMMPfam	IPR000536	450	618	PF00104	Nuclear hormone receptor
HMMSmart	IPR001628	140	212	SM00399	Zinc finger
HMMSmart	IPR000536	447	605	SM00430	Nuclear hormone receptor
ProfileScan	IPR001628	140	216	PS51030	Zinc finger
ScanRegExp	IPR001628	143	169	PS00031	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp