ORK02073

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02073

Order Kazusa clone(s) from :

Accession No	AB208825
Product ID	ORK02073
Clone name	hh00532
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PCBP2
cDNA sequence	DNA sequence (1342 bp) Predicted protein sequence (373 aa)
HaloTag ORF Clone	FHC02073
Flexi ORF Clone	FXC02073
Description	Poly(rC)-binding protein 2 (Alpha-CP2) (hnRNP-E2).

Features of the cloned cDNA sequence

Description

Length: 1342 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	172 bp
Genome contig ID	gi89161190f_52034775
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- CTCGTGATTTTTTAATTAAAGCGTTTTAATTCCTT
Flanking genome sequence (124892 - 124941)	----+--------+--------+--------+--------+----* TCTCTGTTCAGCTGTTGATGCTGAGATCCATATTTAGTTTTATAAGCTTC

Features of the protein sequence

Description

Length: 373 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92062	5.7e-144	100.0	poly(rC)-bindin...	Homo sapiens
ACC69194	4.3e-139	100.0	poly(rC) bindin...	Mus musculus
Q61990	2.4e-138	99.7	Poly(rC)-bindin...	Mus musculus
Q15366	5.9e-138	98.9	Poly(rC)-bindin...	Homo sapiens
AAH71942	3.3e-137	98.6	Poly(rC) bindin...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004088	27	87	PF00013	K Homology
	IPR004088	111	174	PF00013	K Homology
	IPR004088	297	359	PF00013	K Homology
HMMSmart	IPR004087	24	92	SM00322	K Homology
	IPR004087	108	179	SM00322	K Homology
	IPR004087	294	364	SM00322	K Homology
ProfileScan	IPR004088	25	87	PS50084	K Homology
	IPR004088	109	174	PS50084	K Homology
	IPR004088	295	359	PS50084	K Homology

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp