ORK02104

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02104

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02104
Clone name	hg04050
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SDCBP2
cDNA sequence	DNA sequence (6657 bp) Predicted protein sequence (225 aa)
HaloTag ORF Clone	FHC02104
Flexi ORF Clone	FXC02104
Description	Syntenin-2 (Syndecan-binding protein 2).

Features of the cloned cDNA sequence

Description

Length: 6657 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	462 bp
Genome contig ID	gi51511747r_1138623
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTGACTATCTTTTGAATAAAGATTTGATTTTAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAACCCTGTCCGCAAAGGTAATTGATTCCCCCAAAACTATTGAAAATAA

Features of the protein sequence

Description

Length: 225 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9H190	2.8e-87	100.0	Syntenin-2; Syn...	Homo sapiens
CAC21716	5.1e-87	99.5	syntenin-2alpha...	Homo sapiens
XP_001167866	1.2e-83	97.2	similar to synt...	Pan troglodytes
EAX10639	8.2e-83	98.1	syndecan bindin...	Homo sapiens
CAC16178	1.2e-82	100.0	syndecan bindin...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	41	118	PF00595	PDZ/DHR/GLGF
HMMPfam	IPR001478	125	197	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	50	121	SM00228	PDZ/DHR/GLGF
HMMSmart	IPR001478	134	200	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	41	120	PS50106	PDZ/DHR/GLGF
ProfileScan	IPR001478	125	200	PS50106	PDZ/DHR/GLGF

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp