ORK02157

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02157

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02157
Clone name	sh04406
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ETS1
cDNA sequence	DNA sequence (5078 bp) Predicted protein sequence (490 aa)
HaloTag ORF Clone	FHC02157
Flexi ORF Clone	FXC02157
Description	v-ets erythroblastosis virus E26 oncogene homolog 1 (avian)

Features of the cloned cDNA sequence

Description

Length: 5078 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3550 bp
Genome contig ID	gi51511727r_127733872
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- ACTGTGTGAAATTAAAAACAAAGAATTTCATTCAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGCTGTGGCTTTGGCTTGATTCTTTCTTGTCTGGATCATGTATTAAAG

Features of the protein sequence

Description

Length: 490 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAE45783	0	100.0	hypothetical pr...	Homo sapiens
XP_001113071	1.5e-208	95.6	v-ets erythrobl...	Macaca mulatta
P15062	9.2e-193	89.6	Transforming pr...	Gallus gallus
AAA48668	9.5e-192	88.5	c-ets protein [...	Gallus gallus
XP_002196766	9.7e-190	87.8	similar to Tran...	Taeniopygia guttata

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000418	384	397	PR00454	Ets
	IPR000418	408	426	PR00454	Ets
	IPR000418	427	445	PR00454	Ets
	IPR000418	446	464	PR00454	Ets
HMMPfam	IPR003118	102	185	PF02198	Sterile alpha motif/pointed
HMMPfam	IPR000418	383	466	PF00178	Ets
HMMSmart	IPR003118	102	185	SM00251	Sterile alpha motif/pointed
HMMSmart	IPR000418	383	468	SM00413	Ets
ProfileScan	IPR000418	384	464	PS50061	Ets
ScanRegExp	IPR000418	386	394	PS00345	Ets
ScanRegExp	IPR000418	430	445	PS00346	Ets

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp