Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02168
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02168
Clone name bm00851
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol SNRNP70
cDNA sequence DNA sequence (1581 bp)
Predicted protein sequence (472 aa)
Flexi ORF Clone FXC02168
Description U1 small nuclear ribonucleoprotein 70 kDa (U1 snRNP 70 kDa) (snRNP70) (U1-70K).
Features of the cloned cDNA sequence

Length: 1581 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 160 bp
Genome contig ID gi42406306f_54180609
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CCCTTGGATTTAAAAATAAAATTAATTTCCTGTTG
Flanking genome sequence
(123065 - 123114)
----+----*----+----*----+----*----+----*----+----*
ATAGTGGGCACCTCGGTTTCTTCCTCACTGCTCTGTTTTCCCCAGAAGGT

Features of the protein sequence

Length: 472 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001156213 2.9e-149 100.0 hypothetical pr...
Pan troglodytes
CAA28352 7.5e-140 98.0 unnamed protein...
Homo sapiens
XP_001112732 8.9e-139 99.5 similar to U1 s...
Macaca mulatta
P08621 1.3e-137 100.0 U1 small nuclea...
Homo sapiens
BAF85809 9.1e-137 99.3 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000504 140 211 PF00076 RNA recognition motif
HMMSmart IPR000504 139 212 SM00360 RNA recognition motif
ProfileScan IPR000504 138 216 PS50102 RNA recognition motif
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp