Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02176
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02176
Clone name bm04925
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol COPS7A
cDNA sequence DNA sequence (1794 bp)
Predicted protein sequence (296 aa)
Flexi ORF Clone FXC02176
Description COP9 signalosome complex subunit 7a (Signalosome subunit 7a) (SGN7a) (JAB1-containing signalosome subunit 7a) (Dermal papilla-derived protein 10).
Features of the cloned cDNA sequence

Length: 1794 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 817 bp
Genome contig ID gi89161190f_6603572
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ATAATATGACGCAGAAATAAATCTATGAGAAATCT
Flanking genome sequence
(107713 - 107762)
----+----*----+----*----+----*----+----*----+----*
ATCTACAAACTACCCTGAACTGGGTATCTTCTGTGTTTGATATTTGTGGA

Features of the protein sequence

Length: 296 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9UBW8 5.9e-104 100.0 COP9 signalosom...
Homo sapiens
BAA91620 1.3e-103 99.6 unnamed protein...
Homo sapiens
XP_543849 1.3e-103 99.6 similar to COP9...
Canis lupus fam...
AAF04307 1.5e-103 99.6 COP9 complex su...
Homo sapiens
XP_001108537 2e-103 99.2 COP9 constituti...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000717 82 177 PF01399 Proteasome component region PCI
HMMSmart IPR000717 108 198 SM00088 Proteasome component region PCI
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp