ORK02182

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02182

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02182
Clone name	bm03493
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	RBBP7
cDNA sequence	DNA sequence (1928 bp) Predicted protein sequence (457 aa)
HaloTag ORF Clone	FHC02182
Flexi ORF Clone	FXC02182
Description	Histone-binding protein RBBP7 (Retinoblastoma-binding protein 7) (RBBP-7) (Retinoblastoma-binding protein p46) (Histone acetyltransferase type B subunit 2) (Nucleosome remodeling factor subunit RBAP46).

Features of the cloned cDNA sequence

Description

Length: 1928 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	381 bp
Genome contig ID	gi89161218r_16672698
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- TCTTGATTGGCTTTGCAGAAATAAAGTTTTAAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAACTTGTGTTTTTTTAAAAGCTTAGTGGGGGGGGGCGGGGGAGTCTAC

Features of the protein sequence

Description

Length: 457 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q16576	2e-188	100.0	Histone-binding...	Homo sapiens
Q60973	4.4e-188	99.7	Histone-binding...	Mus musculus
XP_857851	5.1e-188	99.7	similar to reti...	Canis lupus fam...
BAE27173	6.9e-188	99.5	unnamed protein...	Mus musculus
BAC37231	8.1e-188	99.5	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	303	334	PD000018	WD40 repeat
BlastProDom	IPR001680	343	378	PD000018	WD40 repeat
FPrintScan	IPR001680	224	238	PR00320	WD40 repeat
	IPR001680	320	334	PR00320	WD40 repeat
	IPR001680	364	378	PR00320	WD40 repeat
HMMPfam	IPR001680	198	237	PF00400	WD40 repeat
	IPR001680	248	287	PF00400	WD40 repeat
	IPR001680	294	333	PF00400	WD40 repeat
	IPR001680	338	377	PF00400	WD40 repeat
	IPR001680	395	434	PF00400	WD40 repeat
HMMSmart	IPR001680	145	184	SM00320	WD40 repeat
	IPR001680	197	237	SM00320	WD40 repeat
	IPR001680	247	287	SM00320	WD40 repeat
	IPR001680	293	333	SM00320	WD40 repeat
	IPR001680	337	377	SM00320	WD40 repeat
	IPR001680	394	434	SM00320	WD40 repeat
ProfileScan	IPR001680	204	246	PS50082	WD40 repeat
	IPR001680	204	443	PS50294	WD40 repeat
	IPR001680	254	296	PS50082	WD40 repeat
	IPR001680	300	336	PS50082	WD40 repeat
	IPR001680	344	386	PS50082	WD40 repeat
	IPR001680	401	435	PS50082	WD40 repeat
ScanRegExp	IPR001680	224	238	PS00678	WD40 repeat
	IPR001680	320	334	PS00678	WD40 repeat
	IPR001680	364	378	PS00678	WD40 repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp