Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02187
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02187
Clone name bm04001
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol RBMXL1
cDNA sequence DNA sequence (2327 bp)
Predicted protein sequence (403 aa)
Flexi ORF Clone FXC02187
Description Kynurenine--oxoglutarate transaminase 3 (EC 2.6.1.7) (Kynurenine-- oxoglutarate transaminase III) (Kynurenine aminotransferase III) (KATIII) (Cysteine-S-conjugate beta-lyase 2) (EC 4.4.1.13).
Features of the cloned cDNA sequence

Length: 2327 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 688 bp
Genome contig ID gi89161185r_89120237
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CTACGGAATACTAAATAAAAAGTTTGGCCAAAACC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACCATGAAGCTGCAAAGGTGCTTGCTCTTACTCTTTCAAATTTTTGCAA

Features of the protein sequence

Length: 403 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH12942 5e-119 100.0 Cysteine conjug...
Homo sapiens
ABB92435 4.9e-117 100.0 RBM1 [Homo sapi...
Homo sapiens
ABB92436 1.8e-116 99.7 RBM1 [Pan trogl...
Pan troglodytes
ABB92439 7.9e-116 99.2 RBM1 [Hylobates...
Hylobates lar
ABB92438 2.3e-115 98.9 RBM1 [Pongo pyg...
Pongo pygmaeus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000504 23 94 PF00076 RNA recognition motif
IPR012604 186 230 PF08081 RBM1CTR
HMMSmart IPR003954 22 95 SM00361 RNA recognition
IPR000504 22 95 SM00360 RNA recognition motif
ProfileScan IPR000504 21 99 PS50102 RNA recognition motif
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp