ORK02188

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02188

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02188
Clone name	bm04245
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CBX3
cDNA sequence	DNA sequence (1804 bp) Predicted protein sequence (184 aa)
HaloTag ORF Clone	FHC02188
Flexi ORF Clone	FXC02188
Description	Chromobox protein homolog 3 (Heterochromatin protein 1 homolog gamma) (HP1 gamma) (Modifier 2 protein) (HECH).

Features of the cloned cDNA sequence

Description

Length: 1804 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1136 bp
Genome contig ID	gi89161213f_26107884
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- CAGTGGTTAATAAATAGTTTTATATTCCTTTATGC
Flanking genome sequence (111617 - 111666)	----+--------+--------+--------+--------+----* AATTATTAGACTTTTTTCTTTATTTGATATGCCTTTACAGTAGAAATAGA

Features of the protein sequence

Description

Length: 184 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDK98641	3.1e-73	100.0	mCG119115, isof...	Mus musculus
Q5R6X7	7.8e-73	100.0	Chromobox prote...	Pongo abelii
XP_926464	1.4e-72	99.4	similar to Chro...	Mus musculus
AAI08371	1.7e-72	99.4	Chromobox homol...	Mus musculus
XP_001499032	1.7e-72	99.4	similar to Chro...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000953	28	36	PR00504	Chromo
	IPR000953	41	55	PR00504	Chromo
	IPR000953	56	68	PR00504	Chromo
HMMPfam	IPR000953	31	80	PF00385	Chromo
HMMPfam	IPR008251	120	177	PF01393	Chromo shadow
HMMSmart	IPR000953	30	82	SM00298	Chromo
	IPR008251	116	178	SM00300	Chromo shadow
	IPR000953	121	173	SM00298	Chromo
ProfileScan	IPR000953	31	89	PS50013	Chromo
ProfileScan	IPR000953	122	180	PS50013	Chromo
ScanRegExp	IPR000953	48	68	PS00598	Chromo

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp