Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02191
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02191
Clone name bm04679
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol NONO
cDNA sequence DNA sequence (2615 bp)
Predicted protein sequence (488 aa)
Flexi ORF Clone FXC02191
Description Non-POU domain-containing octamer-binding protein (NonO protein) (54 kDa nuclear RNA- and DNA-binding protein) (p54(nrb)) (p54nrb) (55 kDa nuclear protein) (NMT55) (DNA-binding p52/p100 complex, 52 kDa subunit).
Features of the cloned cDNA sequence

Length: 2615 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1091 bp
Genome contig ID gi89161218f_70320255
PolyA signal sequence
(ATTAAA,-24)		 
+----*----+----*----+----*----+----
AGCATCAACCTATTAAAATACATTTTAAGCCTTTT
Flanking genome sequence
(117488 - 117537)		 
----+----*----+----*----+----*----+----*----+----*
AATTTTCTGTGGTGTTTTTGAAGGGGAAAGGAGGGAGGGGAGTTATCTTA

Features of the protein sequence

Length: 488 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q5RFL9 7.7e-137 100.0 Non-POU domain-...
 Pongo abelii
AAP36526 7.8e-137 100.0 non-POU domain ...
 synthetic construct
BAE01678 1.1e-136 99.7 unnamed protein...
 Macaca fascicularis
AAC37578 1.6e-136 99.7 unnamed protein...
 Homo sapiens
BAF83829 2.7e-136 99.5 unnamed protein...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000504 93 158 PF00076 RNA recognition motif
IPR000504 167 227 PF00076 RNA recognition motif
IPR012975 238 289 PF08075 NOPS
HMMSmart IPR000504 92 159 SM00360 RNA recognition motif
IPR000504 166 242 SM00360 RNA recognition motif
ProfileScan IPR000504 91 163 PS50102 RNA recognition motif
IPR000504 165 246 PS50102 RNA recognition motif
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp