ORK02196

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02196

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02196
Clone name	bm05593
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	STX1A
cDNA sequence	DNA sequence (2068 bp) Predicted protein sequence (289 aa)
HaloTag ORF Clone	FHC02196
Flexi ORF Clone	FXC02196
Description	Syntaxin-1A (Neuron-specific antigen HPC-1).

Features of the cloned cDNA sequence

Description

Length: 2068 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1196 bp
Genome contig ID	gi89161213r_72651477
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TGAAATTTTTATGTAGAATAAACATTTGTATCTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCAGGCCTCTGTTGTAGATTTCTTCCCCAGGTCTCCTGGGGGAAAACCT

Features of the protein sequence

Description

Length: 289 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q16623	9e-94	100.0	Syntaxin-1A; Ne...	Homo sapiens
BAA01231	2.3e-93	98.9	HPC-1 antigen [...	Rattus norvegicus
Q5R4L2	2.9e-93	99.6	Syntaxin-1A.	Pongo abelii
P32851	4.3e-93	98.9	Syntaxin-1A; Sy...	Rattus norvegicus
AAF64478	9.4e-93	98.9	syntaxin 1A [Ma...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006011	30	132	PF00804	Syntaxin
HMMPfam	IPR000727	198	260	PF05739	Target SNARE coiled-coil region
HMMSmart	IPR006011	26	147	SM00503	Syntaxin
HMMSmart	IPR000727	188	255	SM00397	Target SNARE coiled-coil region
ProfileScan	IPR000727	193	255	PS50192	Target SNARE coiled-coil region
ScanRegExp	IPR006012	199	238	PS00914	Syntaxin/epimorphin coiled-coil

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	267	IMIIICCVILGIVIASTVGGIFA	289	PRIMARY	23