Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02198
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02198
Clone name bm05940
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol APLP1
cDNA sequence DNA sequence (2387 bp)
Predicted protein sequence (656 aa)
Flexi ORF Clone FXC02198
Description Amyloid-like protein 1 precursor (APLP) (APLP-1) [Contains: C30].
Features of the cloned cDNA sequence

Length: 2387 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 350 bp
Genome contig ID gi42406306f_40951295
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CCTACTAACATCCCAATAAAGTCCTCTTCCCTACC
Flanking genome sequence
(111240 - 111289)
----+----*----+----*----+----*----+----*----+----*
AGGCCAGTCTGAGTCTCTGTGGGAGAATTAGTCTGTAACCACAGCTGGAC

Features of the protein sequence

Length: 656 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P51693 0 100.0 Amyloid-like pr...
Homo sapiens
AAB96331 0 99.8 amyloid precurs...
Homo sapiens
BAG35219 0 99.8 unnamed protein...
Homo sapiens
NP_001019978 0 99.8 amyloid precurs...
Homo sapiens
BAE01947 0 98.0 unnamed protein...
Macaca fascicularis
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR008155 206 224 PR00203 Amyloidogenic glycoprotein
IPR008155 307 330 PR00203 Amyloidogenic glycoprotein
IPR008155 585 610 PR00203 Amyloidogenic glycoprotein
IPR008155 632 654 PR00203 Amyloidogenic glycoprotein
HMMPfam IPR008154 52 217 PF02177 Amyloidogenic glycoprotein
HMMSmart IPR008154 52 217 SM00006 Amyloidogenic glycoprotein
ScanRegExp IPR008155 210 217 PS00319 Amyloidogenic glycoprotein
IPR008155 643 650 PS00320 Amyloidogenic glycoprotein

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 25 PLPLLLPLLLLLLRAQPAIGSLA 47 SECONDARY 23
2 588 VSGLLIMGAGGGSLIVLSMLLL 609 PRIMARY 22
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp