ORK02217

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02217

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02217
Clone name	ek00172
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	APLP2
cDNA sequence	DNA sequence (3511 bp) Predicted protein sequence (705 aa)
HaloTag ORF Clone	FHC02217
Flexi ORF Clone	FXC02217
Description	Amyloid-like protein 2 precursor (Amyloid protein homolog) (APPH) (CDEI box-binding protein) (CDEBP).

Features of the cloned cDNA sequence

Description

Length: 3511 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1360 bp
Genome contig ID	gi51511727f_129345020
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTTAAACACATCAATAAATACTTTAACTTCCACCG
Flanking genome sequence (174895 - 174944)	----+--------+--------+--------+--------+----* AGACTGCTCGTTTCACTGACTGCGGCATTGATCTGCGTGATGGTCCTACC

Features of the protein sequence

Description

Length: 705 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAA35601	100.0	binding protein...	Homo sapiens
XP_001155464	99.1	amyloid beta (A...	Pan troglodytes
BAE01992	98.2	unnamed protein...	Macaca fascicularis
XP_856822	94.3	similar to amyl...	Canis lupus fam...
EAW67769	100.0	amyloid beta (A...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR008155	203	221	PR00203	Amyloidogenic glycoprotein
	IPR008155	335	358	PR00203	Amyloidogenic glycoprotein
	IPR008155	634	659	PR00203	Amyloidogenic glycoprotein
	IPR008155	680	702	PR00203	Amyloidogenic glycoprotein
HMMPfam	IPR008154	52	214	PF02177	Amyloidogenic glycoprotein
HMMSmart	IPR008154	52	214	SM00006	Amyloidogenic glycoprotein
ScanRegExp	IPR008155	207	214	PS00319	Amyloidogenic glycoprotein
ScanRegExp	IPR008155	691	698	PS00320	Amyloidogenic glycoprotein

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	23	GRLLLLLLVGLTAPALALAGYIE	45	PRIMARY	23
SOSUI2	2	634	SSALIGLLVIAVAIATVIVISLV	656	PRIMARY	23