ORK02368

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02368

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02368
Clone name	fh22923
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ATOH8
cDNA sequence	DNA sequence (5746 bp) Predicted protein sequence (339 aa)
HaloTag ORF Clone	FHC02368
Flexi ORF Clone	FXC02368
Description	atonal homolog 8

Features of the cloned cDNA sequence

Description

Length: 5746 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4486 bp
Genome contig ID	gi89161199f_85734530
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TGCTGAATGAATGAATAAAACATGGAAAATGTGGT
Flanking genome sequence (137483 - 137532)	----+--------+--------+--------+--------+----* AATTCACTCATTTTTGTTTTCTTCCTTCCACAAATAACTCCCAAGCATCT

Features of the protein sequence

Description

Length: 339 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH94832	2.5e-81	100.0	Atonal homolog ...	Homo sapiens
EAW99481	3.6e-81	99.6	atonal homolog ...	Homo sapiens
Q96SQ7	5.8e-81	99.6	Protein atonal ...	Homo sapiens
XP_873292	1e-71	91.3	similar to Aton...	Bos taurus
EDL91017	5.5e-67	87.4	similar to bHLH...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001092	249	301	PF00010	Basic helix-loop-helix dimerisation region bHLH
HMMSmart	IPR001092	254	306	SM00353	Basic helix-loop-helix dimerisation region bHLH
ProfileScan	IPR001092	246	301	PS50888	Basic helix-loop-helix dimerisation region bHLH

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp