ORK02613

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02613

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02613
Clone name	bm07084
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	LHX1
cDNA sequence	DNA sequence (1399 bp) Predicted protein sequence (443 aa)
HaloTag ORF Clone	FHC02613
Flexi ORF Clone	FXC02613
Description	LIM homeobox 1

Features of the cloned cDNA sequence

Description

Length: 1399 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	66 bp
Genome contig ID	gi51511734f_32269496
PolyA signal sequence (AAGAAA,-11)	+--------+--------+----*----+---- TTGTACAGAAATGAACCTTTATTTAAGAAAAATAG
Flanking genome sequence (105113 - 105162)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAACATAAAAAGCAAGTCCCCACCCCCTTCCTCCAGCCTC

Features of the protein sequence

Description

Length: 443 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_852897	1.8e-147	97.9	similar to LIM ...	Canis lupus fam...
P48742	1.2e-142	100.0	LIM/homeobox pr...	Homo sapiens
Q5IS44	2.2e-142	99.7	LIM/homeobox pr...	Pan troglodytes
AAI53213	3.1e-142	99.5	LHX1 protein [B...	Bos taurus
P63007	3.5e-142	99.5	LIM/homeobox pr...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001781	40	94	PD000094	Zinc finger
	IPR001781	98	155	PD000094	Zinc finger
	IPR001356	217	276	PD000010	Homeobox
FPrintScan	IPR001356	254	264	PR00024	Homeobox
FPrintScan	IPR001356	264	273	PR00024	Homeobox
HMMPfam	IPR001781	41	97	PF00412	Zinc finger
	IPR001781	100	160	PF00412	Zinc finger
	IPR001356	218	274	PF00046	Homeobox
HMMSmart	IPR001781	40	91	SM00132	Zinc finger
	IPR001781	99	154	SM00132	Zinc finger
	IPR001356	217	279	SM00389	Homeobox
ProfileScan	IPR001781	39	98	PS50023	Zinc finger
	IPR001781	99	161	PS50023	Zinc finger
	IPR001356	215	275	PS50071	Homeobox
ScanRegExp	IPR001781	41	75	PS00478	Zinc finger
	IPR001781	100	135	PS00478	Zinc finger
	IPR001356	250	273	PS00027	Homeobox

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp