ORK02646

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02646

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02646
Clone name	bm11029
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	ZNF3
cDNA sequence	DNA sequence (2569 bp) Predicted protein sequence (494 aa)
HaloTag ORF Clone	FHC02646
Flexi ORF Clone	FXC02646
Description	zinc finger protein 3

Features of the cloned cDNA sequence

Description

Length: 2569 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	966 bp
Genome contig ID	gi89161213r_99405736
PolyA signal sequence (None)	+--------+--------+----*----+---- ATTAATGCAGAGAAAGAGCAAAGCCCAAAAGGGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAACAAAAAAACAAAAAAACGAAGCCCAGAGAAGGCAGGCTGT

Features of the protein sequence

Description

Length: 494 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P17036	4.9e-187	100.0	Zinc finger pro...	Homo sapiens
XP_519246	8.8e-187	99.7	zinc finger pro...	Pan troglodytes
CAH10562	2.5e-186	99.7	hypothetical pr...	Homo sapiens
XP_001915564	4.1e-174	93.0	zinc finger pro...	Equus caballus
AAP35564	2.1e-172	100.0	zinc finger pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	248	271	PD000003	Zinc finger
	IPR007087	276	299	PD000003	Zinc finger
	IPR007087	304	327	PD000003	Zinc finger
	IPR007087	332	355	PD000003	Zinc finger
	IPR007087	360	383	PD000003	Zinc finger
	IPR007087	388	411	PD000003	Zinc finger
	IPR007087	416	439	PD000003	Zinc finger
	IPR007087	444	467	PD000003	Zinc finger
HMMPfam	IPR001909	99	139	PF01352	KRAB box
	IPR007087	248	270	PF00096	Zinc finger
	IPR007087	276	298	PF00096	Zinc finger
	IPR007087	304	326	PF00096	Zinc finger
	IPR007087	332	354	PF00096	Zinc finger
	IPR007087	360	382	PF00096	Zinc finger
	IPR007087	388	410	PF00096	Zinc finger
	IPR007087	416	438	PF00096	Zinc finger
	IPR007087	444	466	PF00096	Zinc finger
HMMSmart	IPR001909	99	154	SM00349	KRAB box
	IPR015880	248	270	SM00355	Zinc finger
	IPR015880	276	298	SM00355	Zinc finger
	IPR015880	304	326	SM00355	Zinc finger
	IPR015880	332	354	SM00355	Zinc finger
	IPR015880	360	382	SM00355	Zinc finger
	IPR015880	388	410	SM00355	Zinc finger
	IPR015880	416	438	SM00355	Zinc finger
	IPR015880	444	466	SM00355	Zinc finger
ProfileScan	IPR001909	99	171	PS50805	KRAB box
	IPR007087	248	275	PS50157	Zinc finger
	IPR007087	276	303	PS50157	Zinc finger
	IPR007087	304	331	PS50157	Zinc finger
	IPR007087	332	359	PS50157	Zinc finger
	IPR007087	360	387	PS50157	Zinc finger
	IPR007087	388	415	PS50157	Zinc finger
	IPR007087	416	443	PS50157	Zinc finger
	IPR007087	444	471	PS50157	Zinc finger
ScanRegExp	IPR007087	250	270	PS00028	Zinc finger
	IPR007087	278	298	PS00028	Zinc finger
	IPR007087	306	326	PS00028	Zinc finger
	IPR007087	334	354	PS00028	Zinc finger
	IPR007087	362	382	PS00028	Zinc finger
	IPR007087	390	410	PS00028	Zinc finger
	IPR007087	418	438	PS00028	Zinc finger
	IPR007087	446	466	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp