Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02728
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02728
Clone name fk11143
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PKNOX2
cDNA sequence DNA sequence (3622 bp)
Predicted protein sequence (475 aa)
Flexi ORF Clone FXC02728
Description PBX/knotted 1 homeobox 2
Features of the cloned cDNA sequence

Length: 3622 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1995 bp
Genome contig ID gi51511727f_124510148
PolyA signal sequence
(AGTAAA,-22)
+----*----+----*----+----*----+----
CCGAGACGTTTTCAGTAAATCTTATTACCTACCGT
Flanking genome sequence
(298347 - 298396)
----+----*----+----*----+----*----+----*----+----*
AACCCTGGTGCACAATTCTCTTTCTGTGGTTGCTGTGGCAATCCTTTGCT

Features of the protein sequence

Length: 475 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96KN3 1.1e-159 100.0 Homeobox protei...
Homo sapiens
ACE87283 2.3e-159 99.7 PBX/knotted 1 h...
synthetic construct
Q5R6L1 7.9e-159 99.3 Homeobox protei...
Pongo abelii
AAH45626 1e-158 99.7 PBX/knotted 1 h...
Homo sapiens
XP_001505126 1.3e-158 99.3 similar to Home...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001356 294 348 PD000010 Homeobox
HMMPfam IPR001356 292 351 PF00046 Homeobox
HMMSmart IPR001356 291 356 SM00389 Homeobox
ProfileScan IPR001356 289 352 PS50071 Homeobox
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp