ORK02802

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02802

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02802
Clone name	fk05467
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NR2F1
cDNA sequence	DNA sequence (3155 bp) Predicted protein sequence (490 aa)
HaloTag ORF Clone	FHC02802
Flexi ORF Clone	FXC02802
Description	nuclear receptor subfamily 2, group F, member 1

Features of the cloned cDNA sequence

Description

Length: 3155 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	274 bp
Genome contig ID	gi51511721f_92845019
PolyA signal sequence (None)	+--------+--------+----*----+---- ACAAACAAAAAAAAGAACCTTGTGTCTGTCTGGTG
Flanking genome sequence (110561 - 110610)	----+--------+--------+--------+--------+----* AAAAAAAGAAAAACAAATTGGAAGAGAGGACCATGAGAATTTTAATAAAA

Features of the protein sequence

Description

Length: 490 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P10589	1.4e-119	100.0	COUP transcript...	Homo sapiens
Q9TTR8	4.8e-119	99.7	COUP transcript...	Bos taurus
Q60632	1.8e-118	99.5	COUP transcript...	Mus musculus
CAA34277	2.6e-118	100.0	COUP-TF [Homo s...	Homo sapiens
AAA19853	7.8e-118	99.0	COUP-TFI [Mus m...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001628	153	219	PD000035	Zinc finger
FPrintScan	IPR001628	153	169	PR00047	Zinc finger
	IPR001628	169	184	PR00047	Zinc finger
	IPR001628	202	210	PR00047	Zinc finger
	IPR001628	210	218	PR00047	Zinc finger
	IPR001723	214	224	PR00398	Steroid hormone receptor
	IPR003068	221	233	PR01282	Transcription factor COUP
	IPR003068	252	267	PR01282	Transcription factor COUP
	IPR003068	282	298	PR01282	Transcription factor COUP
	IPR001723	289	310	PR00398	Steroid hormone receptor
	IPR001723	310	326	PR00398	Steroid hormone receptor
	IPR003068	336	354	PR01282	Transcription factor COUP
	IPR003068	356	370	PR01282	Transcription factor COUP
	IPR001723	379	394	PR00398	Steroid hormone receptor
	IPR003068	395	407	PR01282	Transcription factor COUP
	IPR001723	436	453	PR00398	Steroid hormone receptor
	IPR003068	442	455	PR01282	Transcription factor COUP
	IPR003068	462	473	PR01282	Transcription factor COUP
	IPR003068	473	486	PR01282	Transcription factor COUP
HMMPfam	IPR001628	151	226	PF00105	Zinc finger
	IPR013629	227	289	PF08420	Zinc finger-associated region
	IPR000536	291	473	PF00104	Nuclear hormone receptor
HMMSmart	IPR001628	150	221	SM00399	Zinc finger
HMMSmart	IPR000536	288	448	SM00430	Nuclear hormone receptor
ProfileScan	IPR001628	150	225	PS51030	Zinc finger
ScanRegExp	IPR001628	153	179	PS00031	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp