ORK03171

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK03171

Order Kazusa clone(s) from :

Accession No
Product ID	ORK03171
Clone name	fk01593
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NFYA
cDNA sequence	DNA sequence (3713 bp) Predicted protein sequence (360 aa)
HaloTag ORF Clone	FHC03171
Flexi ORF Clone	FXC03171
Description	Nuclear transcription factor Y subunit alpha (Nuclear transcription factor Y subunit A) (NF-YA) (CAAT-box DNA-binding protein subunit A).

Features of the cloned cDNA sequence

Description

Length: 3713 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2562 bp
Genome contig ID	gi89161210f_41048681
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TGTTATTTTTTAAAATAAATTTATAAAAATAACCG
Flanking genome sequence (127010 - 127059)	----+--------+--------+--------+--------+----* AAAAGTAATGTGACTTTTGAGGAATCTGCAACTCCTGGGTTCTAGTTTGT

Features of the protein sequence

Description

Length: 360 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI20286	1.3e-101	100.0	nuclear transcr...	Homo sapiens
CAA39023	2.4e-101	99.6	CAAT-box DNA bi...	Mus musculus
AAH39244	3.9e-101	99.6	NFYA protein [H...	Homo sapiens
AAH29695	4.5e-101	99.3	Nuclear transcr...	Mus musculus
EAX04017	1.4e-98	98.1	nuclear transcr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001289	276	343	PD003860	CCAAT-binding transcription factor
FPrintScan	IPR001289	277	299	PR00616	CCAAT-binding transcription factor
FPrintScan	IPR001289	308	331	PR00616	CCAAT-binding transcription factor
HMMPfam	IPR001289	275	331	PF02045	CCAAT-binding transcription factor
HMMSmart	IPR001289	273	334	SM00521	CCAAT-binding transcription factor
ProfileScan	IPR001289	274	334	PS51152	CCAAT-binding transcription factor
ScanRegExp	IPR001289	279	299	PS00686	CCAAT-binding transcription factor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp