ORK04166

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04166

Order Kazusa clone(s) from :

Accession No	AB209661
Product ID	ORK04166
Clone name	hm00182
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ARHGEF3
cDNA sequence	DNA sequence (3992 bp) Predicted protein sequence (537 aa)
Description	Rho guanine nucleotide exchange factor 3 (Exchange factor found in platelets and leukemic and neuronal tissues) (XPLN).

Features of the cloned cDNA sequence

Description

Length: 3992 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1849 bp
Genome contig ID	gi89161205r_56636489
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CTGGAAGTATTTCAAATAAATTACATTATTAAGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCCTCCATGTGTACAGTGTTTGTCCTACAAACAAAATACAGGTTTCAGC

Features of the protein sequence

Description

Length: 537 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92898	0	100.0	Rho guanine nuc...	Homo sapiens
NP_001122088	0	99.8	rho guanine nuc...	Homo sapiens
XP_001101218	4.5e-209	99.4	Rho guanine nuc...	Macaca mulatta
EAW65326	5.3e-208	97.2	Rho guanine nuc...	Homo sapiens
AAH68513	5.7e-208	97.2	ARHGEF3 protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	137	314	PF00621	DH
HMMPfam	IPR001849	353	460	PF00169	Pleckstrin-like
HMMSmart	IPR000219	137	314	SM00325	DH
HMMSmart	IPR001849	346	462	SM00233	Pleckstrin-like
ProfileScan	IPR000219	133	315	PS50010	DH
ProfileScan	IPR001849	302	460	PS50003	Pleckstrin-like
ScanRegExp	IPR001331	263	288	PS00741	Guanine-nucleotide dissociation stimulator

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp