ORK04252

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04252

Order Kazusa clone(s) from :

Accession No	AB209217
Product ID	ORK04252
Clone name	fj11209
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DDX39B
cDNA sequence	DNA sequence (4300 bp) Predicted protein sequence (310 aa)
Description	Spliceosome RNA helicase BAT1 (EC 3.6.1.-) (DEAD box protein UAP56) (56 kDa U2AF65-associated protein) (ATP-dependent RNA helicase p47) (HLA-B-associated transcript-1).

Features of the cloned cDNA sequence

Description

Length: 4300 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3357 bp
Genome contig ID	gi89161210r_31506027
PolyA signal sequence (ACTAAA,-10)	+--------+--------+----*----+---- TTTGTCAGAATTTTTTTTTAACAAAACTAAAAATG
Flanking genome sequence (99975 - 99926)	----+--------+--------+--------+--------+----* AAACACATGTGTCTGTGGTATCTATAAGTGCTTCGTCCCTTTATTGTATT

Features of the protein sequence

Description

Length: 310 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92454	1.2e-133	100.0	HLA-B associate...	Homo sapiens
EAX03412	3.4e-123	100.0	hCG2005638, iso...	Homo sapiens
BAE42496	1.7e-112	98.1	unnamed protein...	Mus musculus
CAI18282	4e-102	100.0	HLA-B associate...	Homo sapiens
CAI18284	5.3e-102	100.0	HLA-B associate...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	89	258	PF00270	DNA/RNA helicase
HMMSmart	IPR014001	84	279	SM00487	DEAD-like helicases
ProfileScan	IPR014014	65	93	PS51195	RNA helicase
ProfileScan	IPR014021	96	269	PS51192	Helicase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp