ORK04440

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04440

Order Kazusa clone(s) from :

Accession No	AB209640
Product ID	ORK04440
Clone name	sh04870
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CASP2
cDNA sequence	DNA sequence (5770 bp) Predicted protein sequence (144 aa)
Description	Caspase-2 precursor (EC 3.4.22.55) (CASP-2) (ICH-1 protease) (NEDD2 protein) (Neural precursor cell expressed developmentally down- regulated protein 2) (NEDD-2) [Contains: Caspase-2 subunit p18; Caspase-2 subunit p13; Caspase-2 subunit p12].

Features of the cloned cDNA sequence

Description

Length: 5770 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1498 bp
Genome contig ID	gi89161213f_142601819
PolyA signal sequence (None)	+--------+--------+----*----+---- GCGTGAGCCACTGCGCCCGGGCAAGACCTTTTTTT
Flanking genome sequence (111967 - 112016)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAACTTCCATTCTTTCTTCCTCCAGTCTGTTCTC

Features of the protein sequence

Description

Length: 144 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92877	1.1e-65	100.0	caspase 2 isofo...	Homo sapiens
BAG64347	5.1e-60	100.0	unnamed protein...	Homo sapiens
XP_001087704	6.5e-60	100.0	similar to Casp...	Macaca mulatta
EAW51861	6.8e-60	100.0	hCG20684, isofo...	Homo sapiens
BAG64447	7.5e-60	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011600	15	137	PF00656	Peptidase C14
HMMSmart	IPR015917	1	139	SM00115	Peptidase C14
ProfileScan	IPR002138	46	139	PS50207	Peptidase C14

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp