Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04606
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209636
Product ID ORK04606
Clone name sh04217
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol COL6A3
cDNA sequence DNA sequence (5866 bp)
Predicted protein sequence (1702 aa)
Description Collagen alpha-3(VI) chain precursor.
Features of the cloned cDNA sequence

Length: 5866 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 756 bp
Genome contig ID gi89161199r_237797400
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CAAAGAAACTTTTTAATAAAGTATATTGAAAGTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CCTGGGTGTGACGTTCTTGGCAGTCTTGTTTCCATAGCAGCGATTGTCAG

Features of the protein sequence

Length: 1702 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92873 0 100.0 alpha 3 type VI...
Homo sapiens
EAW71105 0 99.9 collagen, type ...
Homo sapiens
EAW71110 0 99.9 collagen, type ...
Homo sapiens
EAW71107 0 99.9 collagen, type ...
Homo sapiens
NP_476508 0 99.8 alpha 3 type VI...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR008161 603 628 PD000007 Collagen helix repeat
IPR008161 653 687 PD000007 Collagen helix repeat
IPR008161 840 862 PD000007 Collagen helix repeat
IPR008161 869 898 PD000007 Collagen helix repeat
IPR002223 1637 1687 PD000222 Proteinase inhibitor I2
FPrintScan IPR002035 163 180 PR00453 von Willebrand factor
IPR002035 202 216 PR00453 von Willebrand factor
IPR002035 472 480 PR00453 von Willebrand factor
IPR002223 1634 1648 PR00759 Proteinase inhibitor I2
IPR002223 1662 1672 PR00759 Proteinase inhibitor I2
IPR002223 1672 1687 PR00759 Proteinase inhibitor I2
HMMPfam IPR002035 1 134 PF00092 von Willebrand factor
IPR002035 164 337 PF00092 von Willebrand factor
IPR008160 563 622 PF01391 Collagen triple helix repeat
IPR008160 629 688 PF01391 Collagen triple helix repeat
IPR008160 720 779 PF01391 Collagen triple helix repeat
IPR008160 780 825 PF01391 Collagen triple helix repeat
IPR008160 839 898 PF01391 Collagen triple helix repeat
IPR002035 927 1106 PF00092 von Willebrand factor
IPR002035 1144 1335 PF00092 von Willebrand factor
IPR002223 1636 1688 PF00014 Proteinase inhibitor I2
HMMSmart IPR002035 1 132 SM00327 von Willebrand factor
IPR002035 162 335 SM00327 von Willebrand factor
IPR002035 361 550 SM00327 von Willebrand factor
IPR002035 925 1104 SM00327 von Willebrand factor
IPR002035 1142 1341 SM00327 von Willebrand factor
IPR002223 1635 1688 SM00131 Proteinase inhibitor I2
ProfileScan IPR002035 1 134 PS50234 von Willebrand factor
IPR002035 164 337 PS50234 von Willebrand factor
IPR002035 363 549 PS50234 von Willebrand factor
IPR002035 927 1106 PS50234 von Willebrand factor
IPR002035 1144 1340 PS50234 von Willebrand factor
IPR003961 1513 1601 PS50853 Fibronectin
IPR002223 1637 1687 PS50279 Proteinase inhibitor I2
ScanRegExp IPR002223 1665 1683 PS00280 Proteinase inhibitor I2
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp