Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04609
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209799
Product ID ORK04609
Clone name bm03489
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol COPS2
cDNA sequence DNA sequence (1955 bp)
Predicted protein sequence (451 aa)
Flexi ORF Clone FXC04609
Description COP9 signalosome complex subunit 2 (Signalosome subunit 2) (SGN2) (JAB1-containing signalosome subunit 2) (Thyroid receptor-interacting protein 15) (TRIP-15) (Alien homolog).
Features of the cloned cDNA sequence

Length: 1955 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 597 bp
Genome contig ID gi51511731r_47106842
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AGGTTTCAAGCAGCAAAATAAACAGTGCAGCTCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATTGTAGTTTGGTTCTTGATGTGTTTTTATTACATTTGGAGTTGTTTT

Features of the protein sequence

Length: 451 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93036 3.5e-175 100.0 COP9 constituti...
Homo sapiens
AAK26250 8.2e-175 100.0 TRIP15-ISO [Hom...
Homo sapiens
AAI14036 2.2e-174 99.7 COP9 constituti...
Bos taurus
BAB26900 9.3e-174 99.3 unnamed protein...
Mus musculus
XP_001380487 4.4e-170 98.2 similar to COP9...
Monodelphis dom...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000717 317 421 PF01399 Proteasome component region PCI
HMMSmart IPR013143 177 351 SM00753 PCI/PINT associated module
IPR000717 353 435 SM00088 Proteasome component region PCI
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp