Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04614
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209221
Product ID ORK04614
Clone name fj13004
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CORO1A
cDNA sequence DNA sequence (4198 bp)
Predicted protein sequence (205 aa)
Description Coronin-1A (Coronin-like protein p57) (Coronin-like protein A) (Clipin-A) (Tryptophan aspartate-containing coat protein) (TACO).
Features of the cloned cDNA sequence

Length: 4198 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 886 bp
Genome contig ID gi51511732f_30003053
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
AAAAAAATCATAATAAAATGGCTTTATTTTCTGGT
Flanking genome sequence
(104846 - 104895)
----+----*----+----*----+----*----+----*----+----*
ACCTCCCAGACTCTGATGACTGGTCCCCTAGACACGCAGTTTGCTGAACC

Features of the protein sequence

Length: 205 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92458 2.1e-79 100.0 hypothetical pr...
Homo sapiens
BAC85606 6.1e-74 100.0 unnamed protein...
Homo sapiens
EDL17420 8.9e-36 85.4 coronin, actin ...
Mus musculus
EAW79909 7.7e-35 100.0 coronin, actin ...
Homo sapiens
P31146 9.3e-35 100.0 Coronin-1A; Cor...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001680 22 60 PF00400 WD40 repeat
HMMSmart IPR001680 19 60 SM00320 WD40 repeat
ProfileScan IPR001680 1 69 PS50294 WD40 repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp