ORK05216

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05216

Order Kazusa clone(s) from :

Accession No	AB209188
Product ID	ORK05216
Clone name	fj01961
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	FMR1
cDNA sequence	DNA sequence (4828 bp) Predicted protein sequence (527 aa)
Description	Fragile X mental retardation 1 protein (Protein FMR-1) (FMRP).

Features of the cloned cDNA sequence

Description

Length: 4828 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2273 bp
Genome contig ID	gi89161218f_146716880
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- AAATTTTTATTAAAAAGTTGCACTTATGAAAAAGC
Flanking genome sequence (123453 - 123502)	----+--------+--------+--------+--------+----* AAAAAATTAGTCTGACAGATGTTTGCTCCTGGTTTTAAATTTCTACATTT

Features of the protein sequence

Description

Length: 527 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92425	2.9e-188	100.0	fragile X menta...	Homo sapiens
EAW61300	1.9e-166	96.5	fragile X menta...	Homo sapiens
Q5R9B4	1.3e-165	95.5	Fragile X menta...	Pongo abelii
EAW61297	7.1e-165	96.1	fragile X menta...	Homo sapiens
AAA52458	7.7e-165	96.1	FMR1 [Homo sapi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004088	136	195	PF00013	K Homology
HMMPfam	IPR004088	199	249	PF00013	K Homology
HMMSmart	IPR004087	133	199	SM00322	K Homology
HMMSmart	IPR004087	200	317	SM00322	K Homology
ProfileScan	IPR004088	134	195	PS50084	K Homology
ProfileScan	IPR004088	202	248	PS50084	K Homology

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp