ORK05242

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05242

Order Kazusa clone(s) from :

Accession No	AB208902
Product ID	ORK05242
Clone name	hj01580
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	FUS
cDNA sequence	DNA sequence (4920 bp) Predicted protein sequence (300 aa)
Description	RNA-binding protein FUS (Oncogene FUS) (Oncogene TLS) (Translocated in liposarcoma protein) (POMp75) (75 kDa DNA-pairing protein).

Features of the cloned cDNA sequence

Description

Length: 4920 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	164 bp
Genome contig ID	gi51511732f_30998972
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- ACCTCTGGTTCCCATTAAAAGTGACCATTTTAGTT
Flanking genome sequence (111454 - 111503)	----+--------+--------+--------+--------+----* AAATTTTGTTCCTCTTCCCCCTTTTCACTTTCCTGGAAGATCGATGTCCC

Features of the protein sequence

Description

Length: 300 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92139	1.6e-102	100.0	fusion (involve...	Homo sapiens
XP_001112596	1.1e-88	99.2	similar to fusi...	Macaca mulatta
EAW52152	1.1e-88	99.2	fusion (involve...	Homo sapiens
XP_001158324	1.1e-88	99.2	similar to pigp...	Pan troglodytes
AAC13543	1.5e-88	98.4	pigpen [Bos tau...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	61	140	PF00076	RNA recognition motif
HMMPfam	IPR001876	196	227	PF00641	Zinc finger
HMMSmart	IPR000504	60	141	SM00360	RNA recognition motif
HMMSmart	IPR001876	198	224	SM00547	Zinc finger
ProfileScan	IPR000504	59	145	PS50102	RNA recognition motif
ProfileScan	IPR001876	196	227	PS50199	Zinc finger
ScanRegExp	IPR001876	200	221	PS01358	Zinc finger

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	YFTSLDLVLIFFLVRFFLLT	20	PRIMARY	20
SOSUI2	2	26	PCFCFFFVLFFHVTKGP	42	SECONDARY	17