Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05301
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209801
Product ID ORK05301
Clone name bm03544
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol GLO1
cDNA sequence DNA sequence (1916 bp)
Predicted protein sequence (188 aa)
Description Lactoylglutathione lyase (EC 4.4.1.5) (Methylglyoxalase) (Aldoketomutase) (Glyoxalase I) (Glx I) (Ketone-aldehyde mutase) (S-D- lactoylglutathione methylglyoxal lyase).
Features of the cloned cDNA sequence

Length: 1916 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1348 bp
Genome contig ID gi89161210r_38651701
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ATACTTATAGACTGAAATAAAATGAAACTTCAAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGACTATGTTTAATTTGTAAACCTTTGTCCATCATGTTCTTTCTTTAAA

Features of the protein sequence

Length: 188 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93038 1.3e-84 100.0 glyoxalase I va...
Homo sapiens
Q04760 1.3e-82 100.0 Lactoylglutathi...
Homo sapiens
AAV38789 1.3e-82 100.0 glyoxalase I [s...
synthetic construct
XP_001173775 3.4e-82 99.4 glyoxalase I is...
Pan troglodytes
1FRO 4e-82 100.0 LACTOYLGLUTATHI...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR011588 44 177 PD002334 Glyoxalase/extradiol ring-cleavage dioxygenase
HMMPfam IPR004360 35 178 PF00903 Glyoxalase/bleomycin resistance protein/dioxygenase
HMMTigr IPR004361 10 188 TIGR00068 Glyoxalase I
ScanRegExp IPR004361 38 59 PS00934 Glyoxalase I
IPR004361 122 138 PS00935 Glyoxalase I
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp