ORK05360

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05360

Order Kazusa clone(s) from :

Accession No	AB208799
Product ID	ORK05360
Clone name	hg04234
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	GRIN2C
cDNA sequence	DNA sequence (6518 bp) Predicted protein sequence (306 aa)
Description	Glutamate [NMDA] receptor subunit epsilon-3 precursor (N-methyl D- aspartate receptor subtype 2C) (NR2C) (NMDAR2C).

Features of the cloned cDNA sequence

Description

Length: 6518 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1143 bp
Genome contig ID	gi51511734r_70251098
PolyA signal sequence (None)	+--------+--------+----*----+---- GGACCGCGCCACTCGCACCATCGAGAATTGGGGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GCGGCCGCCGTGCGCCCCCACCGTCCCCCTGCCCGACCCCGCGGTCTGGC

Features of the protein sequence

Description

Length: 306 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92036	4.3e-135	100.0	N-methyl-D-aspa...	Homo sapiens
EAW89202	5.1e-129	99.0	glutamate recep...	Homo sapiens
AAH41128	5.3e-129	99.0	Similar to glut...	Homo sapiens
NP_000826	6.6e-129	99.0	glutamate [NMDA...	Homo sapiens
Q14957	6.6e-129	99.0	Glutamate [NMDA...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	262	302	PD245531	NULL
FPrintScan	IPR001508	106	134	PR00177	NMDA receptor
	IPR001508	191	216	PR00177	NMDA receptor
	IPR001508	231	255	PR00177	NMDA receptor
	IPR001508	262	289	PR00177	NMDA receptor
HMMPfam	IPR001320	187	300	PF00060	Ionotropic glutamate receptor
HMMSmart	IPR001320	75	270	SM00079	Ionotropic glutamate receptor

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	190	VWVMMFVMCLTVVAITVFMFEYF	212	PRIMARY	23
SOSUI2	2	259	TSKIMVLVWAFFAVIFLASYTAN	281	SECONDARY	23