Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05471
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209303
Product ID ORK05471
Clone name fk08328
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol HTATSF1
cDNA sequence DNA sequence (3019 bp)
Predicted protein sequence (758 aa)
Description HIV Tat-specific factor 1 (Tat-SF1).
Features of the cloned cDNA sequence

Length: 3019 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 329 bp
Genome contig ID gi89161218f_135306904
PolyA signal sequence
(AATAAA,-32)
+----*----+----*----+----*----+----
ATCAATAAAAATGAGTTGATAATATGCAGAAACTG
Flanking genome sequence
(115265 - 115314)
----+----*----+----*----+----*----+----*----+----*
AAAATTGGACTTGAGTTAAATTGCATTTTAAATTCTTGATATTGCTTTAT

Features of the protein sequence

Length: 758 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92540 0 100.0 HIV TAT specifi...
Homo sapiens
O43719 0 99.6 HIV Tat-specifi...
Homo sapiens
AAP36261 0 99.6 HIV TAT specifi...
synthetic construct
Q5RB63 0 98.2 HIV Tat-specifi...
Pongo abelii
AAB18823 0 98.2 Tat-SF1 [Homo s...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000504 138 216 PF00076 RNA recognition motif
IPR000504 291 347 PF00076 RNA recognition motif
HMMSmart IPR000504 137 217 SM00360 RNA recognition motif
IPR000504 268 348 SM00360 RNA recognition motif
ProfileScan IPR000504 136 221 PS50102 RNA recognition motif
IPR000504 267 352 PS50102 RNA recognition motif
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp