ORK05543

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05543

Order Kazusa clone(s) from :

Accession No	AB208885
Product ID	ORK05543
Clone name	sj03130
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ITGA4
cDNA sequence	DNA sequence (4868 bp) Predicted protein sequence (854 aa)
Description	Integrin alpha-4 precursor (Integrin alpha-IV) (VLA-4) (CD49d antigen).

Features of the cloned cDNA sequence

Description

Length: 4868 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2228 bp
Genome contig ID	gi89161199f_181948163
PolyA signal sequence (AATAAA,-14)	+--------+--------+----*----+---- GCAAAGTTTTTTTGTGTGTCCAATAAACACATTGT
Flanking genome sequence (162550 - 162599)	----+--------+--------+--------+--------+----* AAAAAAAAGAATTTGAATTGATATCTAAAAACAGAATTTGAATTGATATT

Features of the protein sequence

Description

Length: 854 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92122	100.0	integrin alpha ...	Homo sapiens
EAX10985	99.7	integrin, alpha...	Homo sapiens
AAB59613	99.7	integrin alpha ...	Homo sapiens
AAI46278	99.6	Integrin, alpha...	synthetic construct
P13612	99.6	Integrin alpha-...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000413	70	82	PR01185	Integrins alpha chain
	IPR000413	89	100	PR01185	Integrins alpha chain
	IPR000413	121	141	PR01185	Integrins alpha chain
	IPR000413	189	213	PR01185	Integrins alpha chain
	IPR000413	252	273	PR01185	Integrins alpha chain
	IPR000413	279	298	PR01185	Integrins alpha chain
	IPR000413	392	405	PR01185	Integrins alpha chain
	IPR000413	810	829	PR01185	Integrins alpha chain
HMMPfam	IPR013517	128	164	PF01839	FG-GAP
	IPR013517	191	225	PF01839	FG-GAP
	IPR013649	285	724	PF08441	Integrin alpha-2
	IPR013513	823	837	PF00357	Integrin alpha chain
HMMSmart	IPR013519	69	122	SM00191	Integrin alpha beta-propellor
	IPR013519	124	180	SM00191	Integrin alpha beta-propellor
	IPR013519	186	241	SM00191	Integrin alpha beta-propellor
	IPR013519	248	305	SM00191	Integrin alpha beta-propellor
ScanRegExp	IPR013513	822	829	PS00242	Integrin alpha chain

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	800	IVIISSSLLLGLIVLLLISYVMW	822	PRIMARY	23