ORK05938

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05938

Order Kazusa clone(s) from :

Accession No	AB209061
Product ID	ORK05938
Clone name	hk00170
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MAZ
cDNA sequence	DNA sequence (4088 bp) Predicted protein sequence (179 aa)
Description	Myc-associated zinc finger protein (MAZI) (Purine-binding transcription factor) (Pur-1) (ZF87) (ZIF87).

Features of the cloned cDNA sequence

Description

Length: 4088 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3547 bp
Genome contig ID	gi51511732f_29626312
PolyA signal sequence (None)	+--------+--------+----*----+---- GGCCCTGAGGCCATGGGACTAGTTCTAGATCGCGA
Flanking genome sequence	None

Features of the protein sequence

Description

Length: 179 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92298	2.2e-66	100.0	Serum amyloid A...	Homo sapiens
EAW79995	2.1e-45	100.0	MYC-associated ...	Homo sapiens
AAH41629	1.1e-37	100.0	MAZ protein [Ho...	Homo sapiens
XP_849559	1.5e-37	100.0	similar to Myc-...	Canis lupus fam...
EAW80002	1.7e-37	100.0	MYC-associated ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	44	66	PF00096	Zinc finger
HMMPfam	IPR007087	72	94	PF00096	Zinc finger
HMMSmart	IPR015880	44	66	SM00355	Zinc finger
HMMSmart	IPR015880	72	94	SM00355	Zinc finger
ProfileScan	IPR007087	44	71	PS50157	Zinc finger
ProfileScan	IPR007087	72	99	PS50157	Zinc finger
ScanRegExp	IPR007087	46	66	PS00028	Zinc finger
ScanRegExp	IPR007087	74	94	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp