Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06027
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209232
Product ID ORK06027
Clone name fj14036
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MPP3
cDNA sequence DNA sequence (4435 bp)
Predicted protein sequence (145 aa)
Description MAGUK p55 subfamily member 3 (Protein MPP3) (Discs large homolog 3).
Features of the cloned cDNA sequence

Length: 4435 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 280 bp
Genome contig ID gi51511734r_39134315
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GTATCACAGGCAAGCTGACCCTGATTCTTTGTACC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGTTAAGTAGCCACTGTCTTTTGTGGGTGGTAGTGGTTAATTTATACA

Features of the protein sequence

Length: 145 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92469 4.8e-61 100.0 palmitoylated m...
Homo sapiens
Q13368 6.3e-54 99.2 MAGUK p55 subfa...
Homo sapiens
AAB36964 6.3e-54 99.2 human homolog o...
Homo sapiens
EAW51661 6.5e-54 99.2 membrane protei...
Homo sapiens
XP_523661 1.9e-53 98.5 palmitoylated m...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR008144 10 85 PF00625 Guanylate kinase
HMMSmart IPR008145 1 133 SM00072 Guanylate kinase/L-type calcium channel region
ProfileScan IPR008144 10 130 PS50052 Guanylate kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp