Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06119
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209089
Product ID ORK06119
Clone name hj04578
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol NCOR2
cDNA sequence DNA sequence (4686 bp)
Predicted protein sequence (1469 aa)
Description Nuclear receptor corepressor 2 (N-CoR2) (Silencing mediator of retinoic acid and thyroid hormone receptor) (SMRT) (SMRTe) (Thyroid-, retinoic-acid-receptor-associated corepressor) (T3 receptor- associating factor) (TRAC) (CTG repeat protein 26) (SMAP270).
Features of the cloned cDNA sequence

Length: 4686 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 0 bp
Genome contig ID gi89161190r_123297092
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GCTGCGGCACACGCCCGAGCTGCCCCTGGCCCCGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GGCCGCTCAAGGAGGGCTCCATCACGCAGGTATGGCCCAGGGCCAGGCAC

Features of the protein sequence

Length: 1469 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92326 0 100.0 nuclear recepto...
Homo sapiens
NP_006303 0 99.8 nuclear recepto...
Homo sapiens
EAW98448 0 99.3 nuclear recepto...
Homo sapiens
EAW98451 0 99.3 nuclear recepto...
Homo sapiens
Q9Y618 0 98.7 Nuclear recepto...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR014778 447 492 PF00249 Myb
IPR014778 630 675 PF00249 Myb
HMMSmart IPR001005 446 494 SM00717 SANT
IPR001005 629 677 SM00717 SANT
ProfileScan IPR001005 631 675 PS50090 SANT
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp